«

»

Fév 15 2015

Du phénotype au génotype avec le logiciel GénieGen

geniegen

 

Auteur : Eric JOURDAN – Professeur de SVT au Lycée Charles Nodier – 39 DOLE

 

 

1- Présentation :

Dans le cadre de l’utilisation du numérique en SVT, voici une présentation du logiciel « GénieGen » réalisé par Jean-François MADRE, et distribué gratuitement sur internet : http://acces.ens-lyon.fr/acces/logiciels/geniegen/presentation-du-logiciel-geniegen

GENIEGEN est un logiciel permettant de faire des analyses de séquences d’ADN et d’ARN et de protéines afin de découvrir l’expression de l’information génétique, les liens entre génotype et phénotype, le polymorphisme des gènes, les familles multigéniques, les prévisions en génétique humaine. Ce logiciel est donc une banque de données sur de nombreuses séquences nucléiques et peptidiques que l’on peut modifier en chargeant de nouvelles séquences dans sa banque de données personnelles.

 

2- Objectifs pédagogiques :

Classe concernée : 1ère S

Illustrations des thèmes : 1A : Expression, stabilité et variation du patrimoine génétique

 

3- Activité envisageable : Voici quelques pistes d’activités réalisables en classe. Libre à chacun de les adapter en fonction du niveau de la classe et du nombre d’élèves.

 

  • Etude du phénotype drépanocytaire :

Ouvrir le logiciel Génie génétique.
Fichier –> Ouvrir –> Betaglob –> sélectionner les fichiers HBBCOD.ADN et BDREPCOD.ADN
Cliquer sur Affichage, puis protéine afin d’afficher la séquence d’ADN.
Afin de comparer les séquences, cliquer sur Action, puis alignement.

drepanocytose

–> Faire comparer la constitution des deux hémoglobines.

 

  • Etude de la transcription de l’ADN :

Ouvrir le logiciel Génie génétique.
Fichier –> Ouvrir –> Betaglob –> sélectionner le fichier HBBCOD.ADN
Cliquer sur Affichage, puis ADN 3′ – 5′ afin d’afficher la séquence complémentaire de l’ADN (brin transcrit)
Cliquer sur Action, puis transcription.

transcription

 
–> Faire comparer les séquences de chaque brin d’ADN avec l’ARNm obtenu lors de la transcription.
–> Faire retrouver le brin d’ADN transcrit.

     

  • Etude de la traduction :

Ouvrir le logiciel Génie génétique.
Fichier –> Entrée d’une séquence
Taper la séquence suivante : AUGGCGUACGGGCCCUUAAAGCAUGCUGAU
Pour cela, mettre en titre séquence 1, puis dans la fenêtre du bas taper la séquence.
Cocher ARN (en bas à droite).
Cliquer sur vérifier puis OK.

seq1

 

Cliquer sur Action –> Traduction –> Du début au codon stop.

trad1

Retaper à nouveau la séquence (séquence 2) en remplaçant le 6ème codon par UAA.
Cliquer sur Action –> Traduction –> Du début au codon stop.
Retaper à nouveau la séquence (séquence 3) en remplaçant le 7ème codon par UAG
Cliquer sur Action –> Traduction –> Du début au codon stop.

trad2

–> Faire comparer les séquences d’acides aminés obtenus dans les 3 cas.
–> Faire déduire de la signification des codons modifiés.